Drug Metabolizing Enzyme (DME) Genotyping Support – Getting Started

The reporter dye information for TaqMan® Drug Metabolism and SNP Genotyping Assays can be found in the context sequence, which is posted on the Thermo Fisher Scientific website and in the Assay Information File (AIF) that is on your assay order CD. The context sequence is the nucleotide sequence surrounding the SNP site. It is provided in the genome strand orientation relative to the NCBI reference genome. The SNP alleles are included in brackets, where the order of the alleles corresponds to the association with probe reporter dyes, where [Allele 1 = VIC™ dye / Allele 2 = FAM™ dye].

For example, the C__27102431_D0 assay, which targets the CYP2D6*4 g.1846G>A SNP, rs3892097, has the following context sequence: 

AGACCGTTGGGGCGAAAGGGGCGTC[C/T]TGGGGGTGGGAGATGCGGGTAAGGG

The VIC™ dye probe is associated with the C allele and the FAM™ dye probe is associated with the T allele.

Note that occasionally the SNP alleles we provide in the context sequence are the complement of those listed on the NCBI website, or of those given in the star allele nomenclature. This is because we provide the context sequence alleles in the reference genome strand orientation, but in this example, RefSNP alleles in dbSNP (NCBI) and the star allele nucleotide changes are provided with respect to the CYP2D6 gene reference sequence that maps to the genome strand: CYP2D6*4 g.1846G>A. In the case of A/T, T/A, C/G, or G/C polymorphisms, it is important to note the context sequence to make sure that you have identified the alleles correctly.

For custom assays, only probe sequences are provided for designs created by the Custom Assay Design Tool (CADT). The alleles corresponding to VIC™ dye and FAM™ dye are determined by the order of the SNP alleles included in brackets of the sequence you submitted for assay design, where the order of the alleles corresponds to the association with probe reporter dyes, where [Allele 1 = VIC™ dye / Allele 2 = FAM™ dye]. If you no longer have the submitted sequences and have trouble determining which allele is detected by each dye based on the probe sequences in the AIF on the CD you can contact tech support for help.

If a custom assay is designed based on the reverse strand sequence, the alleles detected by each dye are the same as they would be for an assay based on the forward strand sequence. For example, if a submitted SNP sequence is …GTC[C/T]TGG … the VIC™ probe sequence in the AIF file may contain …GTCCTGG… or the reverse complement …CCAGGAC… and the FAM™ probe sequence may contain …GTCTTGG… or the reverse complement …CCAAGAC… of the context sequence. Both the forward and reverse strand VIC™ probes target the C allele and both FAM™ probes target the T allele of the SNP.

We recommend using the TaqMan® Genotyping Master Mix. TaqMan® Genotyping Assays are also compatible with Universal Master Mix II and Sample-to-SNP™ GTXpress™ Master Mix reagents.

Star alleles are gene‐level haplotypes (a set of DNA polymorphisms that tend to be inherited together on the same chromosome). In many cases, these haplotypes have been associated with DME activity levels (e.g., functional, decreased function, or nonfunctional variants). The combination of star allele haplotypes (i.e., the diplotype) within a sample can be used to predict the DME phenotype (e.g., ultrarapid, extensive, intermediate, or poor). Genetic variants within a haplotype can include SNPs, InDels, and CNVs. The allele nomenclature for a specific gene family is maintained and standardized by an affiliated group of scientists that curate each site independently. This nomenclature can be complicated, because many alleles contain more than one polymorphism (i.e., they are haplotypes) and conversely, many polymorphisms are associated with several alleles.

The star allele nomenclature contains the DME gene name, such as CYP2D6, followed by a numeric allele name, such as *3. A star allele conventionally contains at least one causative variant (e.g., a frameshift mutation). Variants are given reference gene and/or cDNA coordinates, such as g.2549delA (full variant name: CYP2D6*3 g.2549delA). The causative star allele variant may be associated with other nucleotide variants in different haplotypes groups; such sub‐alleles are denoted by letters following the numeric allele identifier (e.g., *3A). On the Cytochrome P450 (CYP) Allele Nomenclature web site, the defining, causative variant for a star allele is often in bold font. 

Note: *1 refers to the reference gene sequence, which has normal function. The reference gene sequence is not necessarily equivalent to the reference genome assembly sequence and it does not necessarily contain the major allele for a given SNP (which can vary between populations, particularly for highly polymorphic SNPs). 

The defining variant for a given DME gene star allele may be the only variant that needs to be interrogated to identify that particular star allele. The defining allele is sometimes referred to as the “common allele”.

Common allele names, and the corresponding TaqMan® DME Genotyping assay, are provided for many DME variants in the PGx Common Markers file.

The public allele nomenclature websites provide information on known DME gene star allele haplotypes, the defining polymorphisms for these alleles, and in many cases, links to the NCBI dbSNP website if an rsSNP identifier has been assigned. Table 1 DME allele nomenclature websites. 

Note: Other DME gene variants/alleles have nomenclature that is reported in the literature, but there is no public nomenclature web site for them. For some key variants, allele nomenclature can be found in the Very Important PGx (VIP) gene summary pages on the Pharmacogenomics Knowledge Base website.

Targets of interest that are not covered by the current Applied Biosystems™ TaqMan® SNP Genotyping collection can be submitted to Custom TaqMan® SNP Assay design. 

The Custom TaqMan® Assay Design Tool (CADT) is available on www.thermofisher.com. Order a custom TaqMan® SNP Genotyping Assay by first entering a sequence with the SNP in brackets, for example [A/G], then submitting the chosen target sites for assay design. Upon notification of successful assay design by email, click the link in the message and add the desired custom assays to your shopping basket. 

CADT can be used to design assays targeting biallelic SNPs or insertion/deletion polymorphisms and multi‐nucleotide polymorphisms (MNPs) that are 6 bases or fewer in length. This tool can also be used to input and order primer and probe sequences of assays that have already been designed that contain FAM™ or VIC™ labels and MGB‐NFQ quenchers. 

Note that sequences must be SNP and repeat‐masked before submission to CADT. Additionally, the genome‐uniqueness for assays must first be established, because custom assays are not compared to the genome (e.g., by BLAT or BLASTn) to determine target specificity. Any target on the “unavailable list” (described on page 25) should not be submitted to CADT, because an assay may be designed but it will fail to function properly. For targets that present assay design challenges, contact our fee‐for‐design custom assay design service at custom.solutions@thermofisher.com.

A reference panel file is a user-generated TaqMan® Genotyper Software file that contains reference samples. Reference samples are data points in an experiment that you select to be representative of the clusters for an individual assay. You can identify, collect, and store reference samples for multiple assays in a reference panel file for use in current or future studies.

After you import a reference panel file into a study, the software uses the reference samples to bias the calls of Unknown data points. Below are instructions how to create a reference panel in the TaqMan® Genotyper Software.

In the current study, select the sample to be included in the reference panel. Click on the Tag menu, and select Tag for Reference Panel. Repeat this for all samples and assays you want to include in your reference panel. When you are ready to analyze a new study, select References under the Setup menu. Click on import, and navigate to the reference panel file (.lap) that you previously saved. You will first need to import your AIF file, and the assays in your reference panel must be included in your assay list.