Search Thermo Fisher Scientific
- Contáctenos
- Orden Rápida
-
¿No tiene una cuenta? Crear una cuenta
Search Thermo Fisher Scientific
Optimize your experiments to get the best results. We’ve compiled a detailed knowledgebase of the top tips and tricks to meet your research needs.
View the relevant questions below:
Having problems with your experiment? Visit our
TaqMan® assays are a fluorescent probe–based detection system. In addition to a pair of PCR primers, a probe labeled with a reporter dye at the 5’ end and a quencher at the 3’ end is present in the qPCR reaction. The probe is designed to bind to the sequence amplified by the primers. During the qPCR reaction, the probe is cleaved by the 5’ exonuclease activity of the Taq DNA Polymerase, releasing the reporter dye and generating a fluorescent signal that increases with each cycle.
Yes, we have assays for human and mouse mitochondrial targets. Please see this application note for more details on how to use the assays.
Check out this page to learn how assays are designed, and why not all assays are exon-spanning.
The probe should be diluted in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0 at 25°C). We recommend storing your probes, both stocks and working solutions, at –20°C in aliquots. This is to reduce the number of times the probe is subject to freeze-thaws. For detailed information on diluting primers and probes, please refer to the tutorial Reconstituting and Diluting Primers and TaqMan® Probes.
You can search for and purchase TaqMan® Gene Expression Assays using our Assay Search Tool. This tool allows you to search for an assay based on gene symbol, gene ID, accession number, or other parameters. The assays of interest can then be purchased directly from the results page using the “add to cart” function. For more information, view our video Finding the Right TaqMan® Gene Expression Assay.
For the target you selected, we compared all assays for that target, and we recommend this assay for standard gene expression experiments because it detects the maximum number of transcripts for your gene of interest. We also evaluated the assays based on the following criteria, and the recommended assay best meets the design criteria below.
We do not take into account anything that may be populated in an “Important Information” field when choosing the “Recommended” assay.
All you need is your Assay ID and the catalog number.
The Assay ID is specific to the gene and its design, and the catalog number denotes the size and reporter dye. You can change these selections by clicking on “FAM| S: 250 rxns”.
Here’s a breakdown of some of the helpful information you can get from the Details section.
1. Assay location: refers to the nucleotide location that is the midpoint of the context sequence for the associated accession number. The context sequence is a 25 bp sequence that contains the probe sequence. To find the context sequence, go to the assay location and count 12 bases on either side. TaqMan® MGB probes are generally 15–18 bases long.
Example: CATTCTAGCTGATCATTGAGATGTCC
25bp context sequence / probe sequence Assay location
2. UniGene: refers to predicted gene expression profile delineated by tissue type.
3. Transgenic Cross-Reactivity Check: To check assays for cross-species reactivity for use in transgenic animal experiments, select the species that you do not want your assay to detect. Assays that are excluded when a species is selected may exhibit species cross-reactivity. Assays that remain will not exhibit species cross-reactivity and thus are suitable to use in a transgenic study.
The Single Sequence Search refers to a 100% match detection of your sequence with a predesigned assay, so you can be certain that the assay will detect your input sequence.
The content presented here is based on the latest genome build in NCBI, and may tell you one of following:
You can use the Results Filter “Transgenic Cross-Reactivity Check” to check for this. Search for the human assay, and then check the box for the species that you do not want the assay to detect. If the assay remains on the page after the search, then it will work for your transgenic experiment because it does not react against that species.
Custom and Custom Plus TaqMan RNA assays can be ordered online with either FAM or VIC dye, with a MGB-NFQ quencher.
Custom and Custom Plus TaqMan RNA assays can be ordered online with either FAM, VIC, or VIC primer limited.
The Custom and Custom Plus TaqMan RNA assays are supplied with the following volumes:
Small: 360 µL
Medium: 750 µL
Large: 976 µL
Please note that the large scale is supplied in a 60X format, while the small and medium scales are supplied in 20X format.
The number of reactions will depend on your final reaction volume. The Custom and Custom Plus TaqMan RNA assays are supplied with the following volumes:
Small: 360 µL (20X)
Medium: 750 µL (20X)
Large: 976 µL (60X)
Assuming a 20 µL final reaction volume, the small size would provide 360 reactions, the medium size would provide 750 reactions, and the large size would provide 2,900 reactions.
For orders placed after March 2016, assay information files can be accessed from this page.
PowerUp™ SYBR™ Green Master Mix can be used in either standard or fast cycling mode and is compatible with all Applied Biosystems™; Real-time PCR instruments (except the 7900HT Fast mode instrument). It is also compatible with the Bio-Rad iQ™ 5, Roche LightCycler™ 480, and Agilent MX3005P systems.
Both master mixes are compatible with all Applied Biosystems™ Real Time PCR instruments, but Power SYBR™ Green Master Mix can only be run in Standard Mode. PowerUp™ SYBR™ Green Master Mix contains a heat-labile UDG, which allows for review of PCR products up to 72 hrs post-PCR (unlike Power SYBR™ Green Master Mix). Finally, PowerUp™ SYBR™ Green Master Mix uses Dual-Lock Taq DNA Polymerase, which uses a combination of two hot start modifications for exceptional specificity.
Pre-assembled qPCR reactions with PowerTrack SYBR Green Master Mix are stable for up to 8 hrs at room temperature before being run, when stored away from light.
SYBR Green I dye has been used in PowerTrack SYBR Green Master Mix because our product development team found the SYBR Green I dye to perform more optimally than SYBR GreenER dye during the development of this master mix.
The incubation time is not required as UNG is active at room temperature and will degrade amplicons with dUs present.
We haven't tested this extensively, but we have tested storage of the cDNA and yellow sample buffer premixed for 2-3 days. For best practice, we recommend keeping the cDNA and yellow sample buffer separate until the reaction set up.
Here is a short list of cell lines that have been validated with the Cells-to-CT system: HeLa, HepG2, primary hepatocytes, SK-N-AS, SK-N-SH, U-87 MG, ME-180, A549, Jurkat, PC-12, PT-K75, NIH/3T3, Raji, HEK-293, COS-7, CHO-K1, NCI-H460, DU-145, K562, U-2 OS, Huh-7, Neuro 2A, and BJ. For additional information please visit the following page.
To identify the maximum number of cells to use for each reaction, we recommend testing a range of cellular input amounts by setting up a serial dilution. Instructions for determining the best cell number input with Fast Advanced Cells-to-CT kits can be found in the User Bulletin: Cell Input Optimization for SYBR Green Fast Advanced Cells-to-CT Kit and the User Bulletin: Cell input optimization for TaqMan Fast Advanced Cells-to-CT Kit. For the non-Fast Advanced Cells-to-CT kits, instructions can be found in the Pilot Experiment section of the protocol for each kit.
Yes. The TaqMan Cells-to-CT Control Kit and SYBR Green Cells-to-CT Control Kit are compatible with the Fast Advanced Cells-to-CT kits and workflow.
There is no reason why the Cells-to-CT system shouldn’t work with any cell line. However, due to differences in cell size and composition, the maximum number of cells per lysis reaction may be slightly different for different cell lines. We recommend testing for inhibition and optimal cell input by using the TaqMan Cells-to-CT and SYBR Green Cells-to-CT Control kits.
1. Ensure that all media is removed from the wells.
2. Wash with an equal volume of room temperature 1X PBS after the media is removed.
3. Ensure that the reaction happens at room temperature (lysis reaction may not reach room temperature if plate is on ice, quickly moved to bench, or cold lysis solution is added).
4. Warm lysis solution to room temperature before adding to cells.
5. Perform lysis reaction at 25 degrees C for up to 8 mins.
We offer a TaqMan Universal DNA Spike-In Control (Cat. No. A39175 or A39176) that can be added to samples before extraction, to monitor recovery efficiency.
The TaqMan Urinary Tract Microbiota Amplification Control (Cat. No. A39174) is a linearized multi-target plasmid with target sequences for each available urinary tract microbiota profiling assay.
We recommend the MagMAX DNA Multi-Sample Ultra Kit (Cat. No. A25597) for isolating DNA for vaginal microbiota profiling experiments.
We recommend the MagMAX DNA Multi-Sample Ultra Kit (Cat. No. A25597) for isolating DNA for urinary tract microbiota profiling experiments.
The TaqMan Vaginal Microbiota Amplification Control (Cat. No. A32040) is a linearized multi-target plasmid with target sequences for each available vaginal microbiota profiling assay.
Check out this helpful bulletin, which describes all the steps from nucleic acid purification to qPCR: Relative Gene Expression Workflow.
You will need to first choose compatible reporter dyes for your instrument. We recommend you to validate your assays, such that you see the same Ct values whether the assay is performed in singleplex or multiplex. Please see this application note for more details on multiplex considerations, recommended dyes, and validation.
AmpErase® UNG (uracil N-glycosylase) is an enzyme utilized in a powerful method for elimination of carryover PCR products in real-time PCR. This method modifies PCR products such that in a new reaction, any residual products from previous PCR amplifications will be digested and prevented from amplifying, but the true DNA templates will be unaffected.
Here is how it works: During amplification, dUTP is substituted for dTTP, resulting in dUTP-containing amplicons. In subsequent reactions, a short pre-PCR incubation step will allow the AmpErase® UNG to digest any dUTP containing DNA. Since AmpErase® UNG is active on both single- and double-stranded dUTP-containing DNA, the procedure should work on dU-containing PCR products from standard or asymmetric PCR amplifications. However, uracil ribonucleotide residues in RNA, novel DNA containing dTTP, or cDNA containing dTTP will not be suitable substrates for UNG, so your templates will be unaffected.
Note that this is a proactive method to prevent contamination from future reactions, but will not help with a preexisting contamination problem of standard dTTP-containing PCR products. That can only be remedied with thorough cleaning of lab surfaces, equipment, and air filters.
A calibrator (or reference sample) is a sample used as the basis for comparing results. For example, in a study of drug effects on gene expression, an untreated control would be an appropriate calibrator.
Absolute quantification (AQ) will quantitate unknowns based on a known quantity. It involves the creation of a standard curve from a target of known quantity (i.e., copy number). Unknowns can then be compared to the standard curve and a value can be extrapolated. Absolute quantitation is useful for quantitating copy number of a certain target in DNA or RNA samples. The result usually is a number followed by a unit, such as copy number and ng.
Relative quantification (RQ) can quantitate a fold difference between samples. It involves the comparison of one sample to another sample (calibrator) of significance. For example, in a drug treatment study you could compare a treated to an untreated sample. The quantity of the calibrator is not known and cannot be measured absolutely. Therefore, the calibrator (untreated sample) and samples (treated samples) are normalized to an endogenous control (a gene that is consistently expressed among the samples) and then compared to each other to get a fold difference. Relative quantitation is useful for quantitating messenger RNA levels. Since the result is a fold change or ratio, it is not followed by a unit.
Technical replicates are simply an additional data point of the exact same sample, and help to monitor for handling errors. Biological replicates are samples that undergo the same treatment or conditions, but came from separate source materials (i.e., two separate mice, or two separate dishes of cells).
An endogenous control, or reference gene, allows for the normalization of the target's gene expression to another gene that is constantly expressed across samples. Usually, the endogenous control is used to normalize for differences in the amount of cDNA used in the PCR reaction as well as any PCR inhibition caused by the sample. Choosing the appropriate endogenous control will depend upon several factors. You will have to validate your own samples to see which candidate control is stably expressed across all of your samples. To select a human endogenous control that best fits your needs, the Human Endogenous Control Plate (Cat. No. 4309920) is a useful tool for evaluating 11 housekeeping genes for their potential function as endogenous controls for mRNA gene expression. You can find more information on the expression of common human and mouse control genes in our application note.
In general, we recommend using 1–100 ng of cDNA per 20 µL qPCR reaction. This amount of input will work for the majority of genes and samples. However, the exact amount to use can best be determined by running a dilution series of your input. Some genes may be expressed at low levels in your samples, in which case more input may be required. If you do not know what level of expression to expect from your sample, you can also refer to literature for published expression profiles.
ROX™ dye is a passive reference that is used to help with data analysis and troubleshooting, such as by reducing the deviation among replicates. ROX can help, but it is not required for the qPCR reaction or the instrument. For use with an Applied Biosystems® real-time PCR instrument, make sure to change the passive reference to “None”, as it will be set to “ROX” by default in all software.
The choice of master mix depends upon the number of assays in your reaction, the application, and instrument compatibility. Please refer to our real-time PCR master mixes and instrument compatibility chart prior to selecting one of the master mixes below:
Single and duplex targets:
- Gene Expression: TaqMan Fast Advanced Master Mix or TaqMan Fast Virus 1-Step Master Mix
- SNP Genotyping: TaqPath ProAmp Master Mix
Multiplexing up to 4 targets:
- Gene Expression: TaqMan Multiplex Master Mix or TaqPath 1-Step Multiplex Master Mix
- SNP Genotyping: TaqMan Multiplex Master Mix
For multiplex assays that include reporter dyes overlapping the ROX channel (i.e. JUN), we recommend using one of our optimized multiplex master mixes that include the passive reference dye, MUSTANG PURPLE. MUSTANG PURPLE is compatible with QuantStudio 5, 6, 7, and 12K Flex, 7500, 7500 Fast, and ViiA 7 real-time PCR instruments.
While not ideal, we also offer master mixes that contain no passive reference dyes. For selection help for master mixes with no passive reference, please contact Technical Support at techsupport@thermofisher.com.
Optimizing multiplex assays for higher performance begins at the assay design stage. For a complete workflow to develop and optimize your multiplex reaction, please visit our TaqMan Multiplex Real-Time (qPCR) Solutions webpage and follow the recommendations outlined in our TaqMan Multiplex PCR Optimization User Guide.
Please visit our TaqMan Multiplex Real-Time (qPCR) Solutions webpage to learn more about multiplexing and how you can apply our multiplex solutions to your experiments.
In general, we prefer MGB-NFQ as a quencher for single and duplex reactions as it allows for shorter probes that are more specific. If you are interested in multiplexing with 3 or more assays, we recommend the QSY probe. The QSY quencher is compatible with a wider variety of dyes (FAM, VIC, ABY, and JUN). Please note that we do not recommend multiplexing with more than two MGB-NFQ assays in a single reaction well.
Yes. The TaqMan Gene Expression Control Kit (Cat. No. A29349) contains TaqMan gene expression assays for eukaryotic 18S ribosomal RNA (rRNA) and human telomerase reverse transcriptase (hTERT) and a sample of human Raji cDNA for use in TaqMan assay-based relative quantitation.
No, in an effort to improve the impact on environmental health and comply with chemical safety labeling, the Detection Enhancer component was removed from the AgPath ID One-Step RT-PCR Reagents. It is now available for purchase separately. Here are the part numbers for the stand-alone Detection Enhancer, for real-time PCR:
Cat. No. A44810: Detection Enhancer, 100 reactions
Cat. No. A44941: Detection Enhancer, 500 reactions
Cat. No. A44811: Detection Enhancer, 1000 reactions
One of the most common methods for analyzing qRT-PCR gene expression data is Relative Quantitation (ddCt). One of the requirements for this type of analysis is the selection of an appropriate endogenous control. An endogenous control is one whose expression does not change across your different samples. Here are some tips for choosing the right endogenous control:
Since there is no way to anticipate how a particular treatment or diseased state will affect expression, the only way to find the right control for certain is to simply test your samples. Here are some easy steps to follow:
1) Identify your candidate genes.
2) Purify RNA using the same method across all your samples.
3) Quantify and use the same amount of RNA from each sample for your RT reactions.
4) Test your candidate control genes.
5) Check the dCt between samples for each candidate.
The analysis workflow in DataAssist™ Software is simple and straightforward, you can import raw data from up to hundreds of plates or TaqMan® Arrays, change analysis settings including selection of normalization controls and method (single or multiple control genes). It provides instant response and fast calculation, allows normalization using multiple reference genes, and provides analysis results in content-rich tables and scalable graphic charts that are easily exported.
Additional analysis features of DataAssist™Software:
(A) – evaluation of potential endogenous controls
(B) – RQ plots
(C) – Volcano plot to identify significant hits
ExpressionSuite™ Software is a free, easy-to-use data analysis tool that utilizes the comparative Ct (ΔΔCt) method to rapidly and accurately quantify relative gene expression across a large number of genes and samples. Its flexibility allows the user to analyze gene expression data on any current Applied Biosystems® real-time PCR instrument. The software showcases an intuitive user interface and enhanced multi-plate analysis features to meet the requirements of emerging markets and future research.
Here are some of the main differences between the two programs.
You can download your TPF plate files from here.
Yes, any user with a lifetechnologies.com account can access the Applied Biosystems analysis modules.
The Applied Biosystems® analysis modules allows analysis of more experiment files and more flexibility in analysis with enhanced file organization.
The software only analyzes data from Life Technologies™ qPCR instruments.
Storage plans for purchase will be announced shortly.
This is roughly the amount of data generated by the analysis of 140 OpenArray® plates.
QuantStudio™ 12K Flex, QuantStudio™ 6 and 7, ViiA™ 7, 7500 Fast (eds files only), 7500, 7900 HT, and StepOne™/ StepOnePlus ™ real-time PCR systems are compatible with Applied Biosystems® qPCR analysis modules?
Data can be combined into a single project, however data must be analyzed separately via the use of analysis groups.
.las files cannot be imported into Applied Biosystems® qPCR analysis modules.
Downloading is not available, but sharing of files and projects is possible.
Analysis Groups is a feature to divide your data based on various groups (like different instruments, for example) and apply specific analysis settings. As data is analyzed, there is a dropdown that can be selected for each analysis group.
Endogenous controls can be set in the analysis settings.
The Interplate calibrator feature enables you to have an endogenous control on any plate.
Here are the system requirements:
Web Browser
Operating System
Network Connectivity
An internet connection capable of 300kbps/300kbps (upload/download) or better. If your network employs a firewall that restricts outbound traffic, it must be configured to allow outbound access to apps.lifetechnologies.com on HTTPS-443.
For Research Use Only. Not for use in diagnostic procedures.