Gene Expression Support—Getting Started

TaqMan® assays are a fluorescent probe–based detection system. In addition to a pair of PCR primers, a probe labeled with a reporter dye at the 5’ end and a quencher at the 3’ end is present in the qPCR reaction. The probe is designed to bind to the sequence amplified by the primers. During the qPCR reaction, the probe is cleaved by the 5’ exonuclease activity of the Taq DNA Polymerase, releasing the reporter dye and generating a fluorescent signal that increases with each cycle.

Yes, we have assays for human and mouse mitochondrial targets. Please see this application note for more details on how to use the assays.

Check out this page to learn how assays are designed, and why not all assays are exon-spanning.

The probe should be diluted in TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0 at 25°C). We recommend storing your probes, both stocks and working solutions, at –20°C in aliquots. This is to reduce the number of times the probe is subject to freeze-thaws. For detailed information on diluting primers and probes, please refer to the tutorial Reconstituting and Diluting Primers and TaqMan® Probes.

You can search for and purchase TaqMan® Gene Expression Assays using our Assay Search Tool. This tool allows you to search for an assay based on gene symbol, gene ID, accession number, or other parameters. The assays of interest can then be purchased directly from the results page using the “add to cart” function. For more information, view our video Finding the Right TaqMan® Gene Expression Assay.

For the target you selected, we compared all assays for that target, and we recommend this assay for standard gene expression experiments because it detects the maximum number of transcripts for your gene of interest. We also evaluated the assays based on the following criteria, and the recommended assay best meets the design criteria below.

• Does not detect gene products with similar sequence (homologs)
• Is designed across an exon–exon junction
• Is an inventoried product, so you get it faster
• Has a short amplicon, giving you a more efficient PCR reaction
• Does not detect off-target sequences, thus increasing the specificity of your reactions (off-target detection may happen when an assay hybridizes with a sequence that occurs more than once in the genome)
• Does not map to multiple genes, thus increasing the specificity of your experiment
• Does not target the 5' untranslated region (UTR). The 5' UTR of transcripts can have variable sequence between transcripts.

We do not take into account anything that may be populated in an “Important Information” field when choosing the “Best Coverage” assay.

All you need is your Assay ID and the catalog number.

The Assay ID is specific to the gene and its design, and the catalog number denotes the size and reporter dye. You can change these selections by clicking on “FAM| S: 250 rxns”.

Here’s a breakdown of some of the helpful information you can get from the Details section.

1. Assay location: refers to the nucleotide location that is the midpoint of the context sequence for the associated accession number. The context sequence is a 25 bp sequence that contains the probe sequence. To find the context sequence, go to the assay location and count 12 bases on either side. TaqMan® MGB probes are generally 15–18 bases long.

Example: CATTCTAGCTGATCATTGAGATGTCC
25bp context sequence / probe sequence Assay location

2. UniGene: refers to predicted gene expression profile delineated by tissue type.

3. Transgenic Cross-Reactivity Check: To check assays for cross-species reactivity for use in transgenic animal experiments, select the species that you do not want your assay to detect. Assays that are excluded when a species is selected may exhibit species cross-reactivity. Assays that remain will not exhibit species cross-reactivity and thus are suitable to use in a transgenic study.

The Single Sequence Search refers to a 100% match detection of your sequence with a predesigned assay, so you can be certain that the assay will detect your input sequence.

The content presented here is based on the latest genome build in NCBI, and may tell you one of following:

1. Detects off-target transcripts (different gene): Any transcript that the assay detects, but is not a 100% match to the assay. For specific transcript information, please call technical support.
2. Detects gDNA: The assay is detecting off-target gDNA.
3. SNP(s) under assay oligo(s): To help evaluate the possible impact of this SNP on your experiment, please refer to the Entrez SNP database human dbsnp131 at NCBI. A higher minor allele frequency in your population represents a higher risk to assay performance.
4. Mitochondrial information: The assay will detect mitochondria.
5. Assay is within 5’ UTR: A primer or probe is within the 5’ untranslated region.

You can use the Results Filter “Transgenic Cross-Reactivity Check” to check for this. Search for the human assay, and then check the box for the species that you do not want the assay to detect. If the assay remains on the page after the search, then it will work for your transgenic experiment because it does not react against that species.

PowerUp™ SYBR™ Green Master Mix can be used in either standard or fast cycling mode and is compatible with all Applied Biosystems™; Real-time PCR instruments (except the 7900HT Fast mode instrument).  It is also compatible with the Bio-Rad iQ™ 5, Roche LightCycler™ 480, and Agilent MX3005P systems.

Both master mixes are compatible with all Applied Biosystems™ Real Time PCR instruments, but Power SYBR™ Green Master Mix can only be run in Standard Mode.  PowerUp™ SYBR™ Green Master Mix contains a heat-labile UDG, which allows for review of PCR products up to 72 hrs post-PCR (unlike Power SYBR™ Green Master Mix).  Finally, PowerUp™ SYBR™ Green Master Mix uses Dual-Lock Taq DNA Polymerase, which uses a combination of two hot start modifications for exceptional specificity.

• To minimize freeze-thaw cycles (keep to under 10), consider diluting 60X assays to 20X working stocks and dividing the solutions into smaller aliquots with 1X TE buffer.
• Use 1–100 ng of cDNA per 20 µL, and use the same amount of cDNA in each reaction. This template quantity is sample dependent.
• Use good-quality RNA. A260/A280 readings should be ~ 1.8–2.0.
• Use a no-template control (NTC) for each assay as a check for template contamination of your reagents.
• Use a no-RT (no reverse transcriptase) control for the detection of genomic DNA contamination, when applicable. (Depending on assay design, it may or may not be able to detect gDNA.)
• Avoid preparing the PCR reaction mix with more than 20% from the reverse transcription reaction.
• Use this guide for a Relative Gene Expression Workflow, which covers choosing a stable normalizer, determining the dynamic range of the reverse transcription, and validating assay amplification efficiencies.

Check out this helpful bulletin, which describes all the steps from nucleic acid purification to qPCR: Relative Gene Expression Workflow.

You will need to first choose compatible reporter dyes for your instrument. We recommend you to validate your assays, such that you see the same Ct values whether the assay is performed in singleplex or multiplex. Please see this application note for more details on multiplex considerations, recommended dyes, and validation.

AmpErase® UNG (uracil N-glycosylase) is an enzyme utilized in a powerful method for elimination of carryover PCR products in real-time PCR. This method modifies PCR products such that in a new reaction, any residual products from previous PCR amplifications will be digested and prevented from amplifying, but the true DNA templates will be unaffected.

Here is how it works: During amplification, dUTP is substituted for dTTP, resulting in dUTP-containing amplicons. In subsequent reactions, a short pre-PCR incubation step will allow the AmpErase® UNG to digest any dUTP containing DNA. Since AmpErase® UNG is active on both single- and double-stranded dUTP-containing DNA, the procedure should work on dU-containing PCR products from standard or asymmetric PCR amplifications. However, uracil ribonucleotide residues in RNA, novel DNA containing dTTP, or cDNA containing dTTP will not be suitable substrates for UNG, so your templates will be unaffected.

Note that this is a proactive method to prevent contamination from future reactions, but will not help with a preexisting contamination problem of standard dTTP-containing PCR products. That can only be remedied with thorough cleaning of lab surfaces, equipment, and air filters.

A calibrator (or reference sample) is a sample used as the basis for comparing results. For example, in a study of drug effects on gene expression, an untreated control would be an appropriate calibrator.

Absolute quantification (AQ) will quantitate unknowns based on a known quantity. It involves the creation of a standard curve from a target of known quantity (i.e., copy number). Unknowns can then be compared to the standard curve and a value can be extrapolated. Absolute quantitation is useful for quantitating copy number of a certain target in DNA or RNA samples. The result usually is a number followed by a unit, such as copy number and ng.

Relative quantification (RQ) can quantitate a fold difference between samples. It involves the comparison of one sample to another sample (calibrator) of significance. For example, in a drug treatment study you could compare a treated to an untreated sample. The quantity of the calibrator is not known and cannot be measured absolutely. Therefore, the calibrator (untreated sample) and samples (treated samples) are normalized to an endogenous control (a gene that is consistently expressed among the samples) and then compared to each other to get a fold difference. Relative quantitation is useful for quantitating messenger RNA levels. Since the result is a fold change or ratio, it is not followed by a unit.

Technical replicates are simply an additional data point of the exact same sample, and help to monitor for handling errors. Biological replicates are samples that undergo the same treatment or conditions, but came from separate source materials (i.e., two separate mice, or two separate dishes of cells). 

An endogenous control, or reference gene, allows for the normalization of the target's gene expression to another gene that is constantly expressed across samples. Usually, the endogenous control is used to normalize for differences in the amount of cDNA used in the PCR reaction as well as any PCR inhibition caused by the sample. Choosing the appropriate endogenous control will depend upon several factors. You will have to validate your own samples to see which candidate control is stably expressed across all of your samples. To select a human endogenous control that best fits your needs, the Human Endogenous Control Plate (Cat. No. 4309920) is a useful tool for evaluating 11 housekeeping genes for their potential function as endogenous controls for mRNA gene expression. You can find more information on the expression of common human and mouse control genes in our application note.

In general, we recommend using 1–100 ng of cDNA per 20 µL qPCR reaction. This amount of input will work for the majority of genes and samples. However, the exact amount to use can best be determined by running a dilution series of your input. Some genes may be expressed at low levels in your samples, in which case more input may be required. If you do not know what level of expression to expect from your sample, you can check if there is a known expression profile in NCBI by following these steps:

1. Search for your TaqMan® Gene Expression Assay using the Assay ID at lifetechnologies.com.
2. Click on the “View Details” button.
3. Click on the UniGene ID hyperlink.
4. Click on the “EST Profile” link under the “Gene Expression” section.

Here you will see an expression profile broken down by tissue type, health stage, or developmental stage. While not exhaustive, these data can give you an idea of what level of expression to expect from your particular samples, or what tissue source would make a good positive control.

ROX™ dye is a passive reference that is used to help with data analysis and troubleshooting, such as by reducing the deviation among replicates. ROX can help, but it is not required for the qPCR reaction or the instrument. For use with an Applied Biosystems® real-time PCR instrument, make sure to change the passive reference to “None”, as it will be set to “ROX” by default in all software.

One of the most common methods for analyzing qRT-PCR gene expression data is Relative Quantitation (ddCt). One of the requirements for this type of analysis is the selection of an appropriate endogenous control. An endogenous control is one whose expression does not change across your different samples. Here are some tips for choosing the right endogenous control:

Since there is no way to anticipate how a particular treatment or diseased state will affect expression, the only way to find the right control for certain is to simply test your samples. Here are some easy steps to follow:

1) Identify your candidate genes.

• Ways to do this include checking the literature, (including our Application Note), or using an array to screen multiple candidate genes.

2) Purify RNA using the same method across all your samples.

3) Quantify and use the same amount of RNA from each sample for your RT reactions.

4) Test your candidate control genes.

5) Check the dCt between samples for each candidate.

• The best control will have a dCt as close to zero as possible (as this means that there is no change in expression across your samples).
• Some of our software, such as ExpressionSuite and DataAssist can do this for you in a QC plot.

The analysis workflow in DataAssist™ Software is simple and straightforward, you can import raw data from up to hundreds of plates or TaqMan® Arrays, change analysis settings including selection of normalization controls and method (single or multiple control genes). It provides instant response and fast calculation, allows normalization using multiple reference genes, and provides analysis results in content-rich tables and scalable graphic charts that are easily exported.

Additional analysis features of DataAssist™Software:
(A) – evaluation of potential endogenous controls
(B) – RQ plots
(C) – Volcano plot to identify significant hits

ExpressionSuite™ Software is a free, easy-to-use data analysis tool that utilizes the comparative Ct (ΔΔCt) method to rapidly and accurately quantify relative gene expression across a large number of genes and samples. Its flexibility allows the user to analyze gene expression data on any current Applied Biosystems® real-time PCR instrument. The software showcases an intuitive user interface and enhanced multi-plate analysis features to meet the requirements of emerging markets and future research.

Here are some of the main differences between the two programs.

1. ExpressionSuite™ Software requires the same endogenous control on every plate; DataAssist™ Software does not.
2. ExpressionSuite™ Software accepts raw data files (*.eds or *.sds), whereas DataAssist™ Software accepts tab-delimited text files (exported study result files from the real-time PCR instrument).
3. You can view the amplification plot, threshold, and multicomponent data in ExpressionSuite™ Software; in DataAssist™ Software you cannot.

You can download your TPF plate files from here.

The Applied Biosystems® analysis modules allows analysis of more experiment files and more flexibility in analysis with enhanced file organization. 

The software only analyzes data from Life Technologies™ qPCR instruments.

Storage plans for purchase will be announced shortly.

This is roughly the amount of data generated by the analysis of 140 OpenArray® plates. 

• Allows access from anywhere using web-based browser
• Enables flexibility of analysis and advanced quality control features
• Accommodates bigger project sizes for multi plate analysis

QuantStudio™ 12K Flex, QuantStudio™ 6 and 7, ViiA™ 7, 7500 Fast (eds files only), 7500, 7900 HT, and  StepOne™/ StepOnePlus ™ real-time PCR systems are compatible with Applied Biosystems® qPCR analysis modules?

Data can be combined into a single project, however data must be analyzed separately via the use of analysis groups.

.las files cannot be imported into Applied Biosystems® qPCR analysis modules.

Downloading is not available, but sharing of files and projects is possible.

Analysis Groups is a feature to divide your data based on various groups (like different instruments, for example) and apply specific analysis settings. As data is analyzed, there is a dropdown that can be selected for each analysis group.

Endogenous controls can be set in the analysis settings. 

The Interplate calibrator feature enables you to have an endogenous control on any plate.

• Select Endo Ctl of choice (not needed on every plate).
• Navigate to Inter-plate Calibrator Settings.  Inter plate calibrator analysis requires the same sample and target combination in a particular well for each plate in a project.
• Select “Allow calculation of dCT across all plates”.  This allows all plates to be analyzed together as one plate.

Here are the system requirements:

Web Browser

• Apple® Safari® 8 Browser
• Google® Chrome™ Browser Version 21 or later
• Microsoft® Internet Explorer® Browser Version 10 or later
• Mozilla® Firefox® Browser Version v10.0.12 or later

Operating System

• Windows® XP, Vista, 7, or 8
• Macintosh® OS 8 or later

Network Connectivity

An internet connection capable of 300kbps/300kbps (upload/download) or better. If your network employs a firewall that restricts outbound traffic, it must be configured to allow outbound access to apps.lifetechnologies.com on HTTPS-443.